Biology > QUESTIONS & ANSWERS > BIOL 234 MIDTERM 1 EXAM-AID ONLINE PACKAGE (All)
1) Draw a typical eukaryotic gene and label its parts with the terms: Promotor, UTR, Exon, Intron, Coding Region, Transcriptional Regulatory Sequences, Terminator. 2) Name one type of intergenic regi... on and explain why it is important to the cell cycle. 3) A female cat has two litters. Her progeny from the first litter are all normal and afterwards her owners decided to feed her a new wet cat food instead of her regular dry cat food. The year later she gave birth to a second litter with lots of health issues. Explain how this could be possible even if there is no mutation in the DNA. 4) The following sequence is a small stretch of DNA containing a sequence that codes for a protein that is 6 amino acids long. Determine the amino acid sequence for this protein. TCGCAGTGTCACGCTAGAGGTACGTGACCGAATAGCATATTGCCATTTACG 5) This mRNA segment contains the coding sequence for a protein made of 5 amino acids 5’- AUGGAACCAUAUUAAUCGC -3’ a) Determine the amino acid sequence. b) The mRNA sequence is mutated to AUGGACCCAUAUUAAUCGC i) Classify the mutation. ii) What does this mutation do to the amino acid sequence? c) The mRNA sequence is mutated to AUGGAACAAUAUUAAUCGC i) Classify the mutation. ii) What does this mutation do to the amino acid sequence? d) The mRNA sequence is mutated to AUGUAACCAUAUUAAUCGC i) Classify the mutation. ii) What does this mutation do to the amino acid sequence? e) The mRNA sequence is mutated to AUGGAACCAUAUUAAUCGC i) Classify the mutation. [Show More]
Last updated: 1 year ago
Preview 1 out of 22 pages
Instant download
Buy this document to get the full access instantly
Instant Download Access after purchase
Add to cartInstant download
Connected school, study & course
About the document
Uploaded On
Aug 01, 2022
Number of pages
22
Written in
This document has been written for:
Uploaded
Aug 01, 2022
Downloads
0
Views
52
In Browsegrades, a student can earn by offering help to other student. Students can help other students with materials by upploading their notes and earn money.
We're available through e-mail, Twitter, Facebook, and live chat.
FAQ
Questions? Leave a message!
Copyright © Browsegrades · High quality services·