*NURSING > TEST BANK > TEST BANK FOR GENETICS AND GENOMICS IN NURSING AND HEALTH CARE 2ND EDITION BY BEERY (All)
Chapter 2: Protein Synthesis Multiple Choice Identify the choice that best completes the statement or answers the question. ____ 1. What is the relationship among genes, DNA, and proteins? A. DNA ... is composed of a series of amino acids that provide the directions for synthesizing proteins. B. Protein is composed of DNA that is organized into specific gene sequences called amino acids. C. A gene is a section of DNA that provides the directions for synthesizing a specific protein. D. Proteins are the nitrogenous bases that form double strands of DNA in its helical shape. ____ 2. What is the best meaning for the term gene expression? A. The location of a specific gene allele on a specific autosomal chromosome B. The specific trait or protein coded for by a single gene is actually present C. The ability of a single gene to code for more than one trait or characteristic D. The loss of a trait or characteristic from one family generation to the next generation ____ 3. What is the difference between DNA transcription for DNA synthesis and DNA transcription for protein synthesis? A. Transcription for DNA synthesis is rapidly followed by the process of translation. B. Transcription for protein synthesis has “greater fidelity” than does transcription for DNA synthesis. C. Transcription for protein synthesis occurs only in cells undergoing mitosis, and transcription for DNA synthesis occurs in both dividing and nondividing cells. D. Transcription for DNA synthesis occurs with both the “sense” and the “antisense” strands, while transcription for protein synthesis occurs with only the “antisense” strand. ____ 4. Which mature messenger RNA strand correctly reflects the accurate transcription of the following segment of DNA, in which large letters represent introns and small letters represent exons? tTGCGaAccaGaCTtaaAAtTAAA A. AUGGUUAUUA B. ACGCTCGATTATTT C. CGCUCGAUUAUUU D. AACGCUUGGUCUGAAUUUUAAUUU ____ 5. What is the function of ribosomes (also known as ribosomal RNA) in protein synthesis? A. Allow interpretation of the two strands of DNA to determine which is the “sense” strand and which is the “antisense” strand B. Serve as the coordinator mechanism to allow proper reading of the mRNA and placement of the correct amino acid in the sequence by the tRNAs C. Allow further processing of synthesized proteins (posttranslational modification) in order to ensure that the final product is physiologically active D. Serve as transport molecules able to move a specific amino acid to the site of protein synthesis (peptide chain elongation) in the correct sequence ____ 6. A strand of recently transcribed mRNA contains the following components: intron (1), intron (2), exon (3), intron (4), exon (5), exon (6), exon (7), intron (8). Which sequence is expected to appear in the mature mRNA? A. 1, 2, 3, 4, 5, 6, 7, 8 B. 2, 3, 4, 5, 6, 7 C. 1, 2, 4, 8 D. 3, 5, 6, 7 ____ 7. Which process occurs outside of the nucleus? A. DNA transcription B. RNA transcription C. Splicing out of introns D. Translation of mRNA ____ 8. What would be the consequence for protein synthesis if only limited amounts of adenine were available in a cell? A. Increased rate of mRNA degradation B. Increased formation of mutation “hot spots” C. Decreased production of cellular proteins D. Decreased amounts of uracil in the cytoplasm ____ 9. Which process would be directly inhibited by a lack of conversion of thymine to uracil? A. Translation B. Transcription C. MicroRNA silencing D. Posttranscriptional modification ____ 10. What would be the sequence of RNA complementary to single-stranded DNA with the base sequence of ACCTGAACGTCGCTA? A. TGGACTTGCAGCGAT B. ACCTGAACGTCGCTA C. UGGACUUGCAGCGAU D. ACCUGAACGUCGCUA [Show More]
Last updated: 1 year ago
Preview 1 out of 12 pages
Buy this document to get the full access instantly
Instant Download Access after purchase
Add to cartInstant download
We Accept:
Connected school, study & course
About the document
Uploaded On
Feb 17, 2021
Number of pages
12
Written in
This document has been written for:
Uploaded
Feb 17, 2021
Downloads
0
Views
86
In Browsegrades, a student can earn by offering help to other student. Students can help other students with materials by upploading their notes and earn money.
We're available through e-mail, Twitter, Facebook, and live chat.
FAQ
Questions? Leave a message!
Copyright © Browsegrades · High quality services·